rs12661628 chr6:144216634 T>C
- Sequence
ttcgaaccccactcctggtagctt[T/C]aggtttttctcttaaatcatttta
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.66 | 0.74 | 1.14 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 2.64 | 0.00 | 1.33 | |||
| MOLM14 (Adult acute myeloid leukemia) | 1.04 | -0.14 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, hdl cholesterol, ldl cholesterol change with statins, obesity with early age of onset (age >2), total cholesterol, total cholesterol change with statins