rs12665224 chr6:159609031 A>T
- Sequence
tgcattgctgcattctctgacttc[A/T]tcttaaagttgtctctcattcttc
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) PANC1 (pancreatic ductal adenocarcinoma) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -1.75 | 2.36 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | n/a | 1.29 | 2.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 0.65 | -0.47 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood