rs12666136 chr7:149625269 C>T
- Sequence
ccggtagatgctacttagcatttt[C/T]taccatgtgtttattacagtaaat
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.01 | 0.58 | 1.50 | |||
| HEK293 (embryonic kidney) | -0.04 | 0.72 | 1.97 | |||
| H929 (plasma cell myeloma) | 1.99 | -1.66 | 1.00 |
Items per page:
1 – 3 of 3