rs12666352 chr7:81781949 C>T
- Sequence
tcgttaactacaccttggatgact[C/T]ttgtatttacatatcttattacat
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
- ASB for transcription factors
- Q8IZH1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| Q8IZH1_HUMAN | -0.36 | 2.28 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, asthma, hdl cholesterol change with statins, ldl cholesterol, stabilized warfarin dose, suicide attempts in bipolar disorder, suicide attempts in bipolar disorder (females), suicide attempts in bipolar disorder (substance abuse/dependence)