rs12668059 chr7:86469867 G>A
- Sequence
gtcccgaccacagaatatggtaca[G/A]ttctgccacctagtggttgccttc
- ASB in cell types
- tibial artery GM10847 (female B-cells Lymphoblastoid Cell Lines) SK-N-SH (neuroblastoma) HMEC (human mammary epithelial cells)
- ASB for transcription factors
- STAG1_HUMAN ZN444_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.17 | 0.83 | 1.00 | n/a | n/a | |||
| ZN444_HUMAN | 2.51 | -2.35 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2