rs12668102 chr7:158977486 C>T
- Sequence
ggtggtcgggggggcacccagctc[C/T]tccactccccacgcccaccacagc
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 2.33 | 0.80 | 1.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.81 | 0.39 | 1.00 |
Items per page:
1 – 2 of 2