rs12668330 chr7:77247419 G>A
- Sequence
ctaccccctggtggcagcatgccc[G/A]aggtgtaggatcaatacctgggaa
- ASB in cell types
- foreskin keratinocyte GM02610 (Lymphoblastoid Cell Lines) HeLa S3 (cervical adenocarcinoma) GM02630 (Fanconi anemi)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.41 | -0.06 | 1.05 | n/a | n/a |
Items per page:
1 – 1 of 1