rs12668723 chr7:116177215 G>A
- Sequence
ttcttcatcctttgactcaggtca[G/A]gaggaatttaactgaggtgaaaga
- ASB in cell types
- bone-marrow-derived mesenchymal stromal cells, osteoblast differentiation day 7
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bone-marrow-derived mesenchymal stromal cells, osteoblast differentiation day 7 | 2.51 | -2.35 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, hdl cholesterol, hdl cholesterol change with statins, ldl cholesterol, ldl cholesterol change with statins, mitral annular calcium, neuroblastoma (brain cancer), tetrology of fallot, total cholesterol, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Pancreas, Pituitary, Testis, Thyroid, Whole_Blood