rs12671154 chr7:150876830 C>T
- Sequence
cttattttactcatcatgtcatcc[C/T]ctatcgtctaccaggcgtccaggc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) RH4 (alveolar rhabdomyosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -1.31 | 1.31 | 1.00 | |||
| RH4 (alveolar rhabdomyosarcoma) | -1.64 | 2.19 | 1.00 |
Items per page:
1 – 2 of 2