rs12672250 chr7:25720606 T>A
- Sequence
aaatcccttatcagctgggtgtta[T/A]tattatccccattttaaagatggg
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.68 | -0.93 | 1.00 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 1.38 | -0.17 | 2.00 |
Items per page:
1 – 2 of 2