rs12673159 chr7:116305682 A>T
- Sequence
cctgacataggtgtgtcaatgtca[A/T]attcccaagatcctgcattccgat
- ASB in cell types
- MCF10A (breast epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10A (breast epithelial cells) | 2.38 | -0.93 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Nerve_Tibial