rs12674335 chr7:149753574 A>G
- Sequence
aaatcaaagtcctgctattgacca[A/G]gaatgtcccctgccccaaggctga
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.76 | -0.30 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, fasting insulin, hdl cholesterol change with statins, homa-ir, recurrent major depressive disorder, simpson-angus scale