rs12679410 chr8:22137439 T>A
- Sequence
accacaagcagcagggagggccac[T/A]gagttccgccaggcccagcagggc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.89 | 0.40 | 1.04 | |||
| IPSC-derived bipolar neuron | 1.84 | -0.53 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood