rs12679658 chr8:20380896 C>T
- Sequence
attgctgtctcctggctgtggggc[C/T]ggcatcctcatttccagggctgga
- ASB in cell types
- foreskin keratinocyte MS-1 (Small cell lung carcinoma) SEM (childhood B acute lymphoblastic leukemia) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
- ASB for transcription factors
- GABP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABP1_HUMAN | n/a | 3.36 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1