rs12680114 chr8:35326843 T>C
- Sequence
atacaaaggaaagtcctgcaggaa[T/C]caccactaggggaggcactgcact
- ASB in cell types
- WA09 (embryonic stem cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.79 | 0.36 | 1.28 | -0.38 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, hip bone mineral density (bmd), late onset alzheimers disease, neuroblastoma (brain cancer), obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio
GTEx eQTL Brain_Cortex, Brain_Frontal_Cortex_BA9, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid