rs12680678 chr8:80107532 A>C
- Sequence
gactacttttaataagtgactcaa[A/C]ccagacgttatctccttctgtctg
- ASB in cell types
- HT29 (colon adenocarcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HT29 (colon adenocarcinoma) | -0.77 | 2.17 | 1.50 | |||
| HepG2 (hepatoblastoma) | 0.16 | 0.91 | 1.13 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Anterior_cingulate_cortex_BA24, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood