rs12682118 chr8:33513778 T>C
- Sequence
tcttttgtgagtcggagtctcgcg[T/C]tgtcgccaggctggagttgcagtg
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) MV-4-11 (Childhood acute monocytic leukemia) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- CHD2_HUMAN ARNT_HUMAN RBM25_HUMAN TEAD3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CHD2_HUMAN | 2.66 | n/a | 1.25 | n/a | n/a | |||
| ARNT_HUMAN | -2.64 | 2.86 | 1.00 | n/a | No Hit | |||
| RBM25_HUMAN | 2.27 | -2.27 | 1.00 | n/a | n/a | |||
| TEAD3_HUMAN | 2.49 | -2.03 | 1.00 | n/a | No Hit | |||
| BACH1_HUMAN | -2.92 | 1.86 | 1.50 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood