rs12685485 chr9:94649298 A>G
- Sequence
tggtcccaccacacccttatgatt[A/G]agtgcagttagcactcccctttgg
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma)
- ASB for transcription factors
- PYGO2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PYGO2_HUMAN | 2.37 | -1.34 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Mucosa, Pituitary, Whole_Blood