rs12691769 chr2:147843969 A>C
- Sequence
tccgccttccaccgactcctcggt[A/C]tcagagcggacgaggcgtcccccc
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.27 | 2.02 | 2.07 | n/a | No Hit |
Items per page:
1 – 1 of 1