rs12691894 chr2:136584374 G>A
- Sequence
acatactagtgcccagcagatggc[G/A]ggtataaagagacatattgaatgt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIC_HUMAN | 2.33 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, aortic valve calcium, biploar disorder (bipolar schizoaffective disorder), body mass index (bmi), college completion, hdl cholesterol, obesity (body mass index (bmi)), salmonella-induced pyroptosis, systolic blood pressure (sbp), triglycerides change with statins, years of education