rs12693181 chr2:179264451 G>C
- Sequence
ggcccaagccggccacccggccgc[G/C]gggcctgcgcgcttctcccgcccg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HCT-116 (colon carcinoma)
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 1.60 | -0.04 | 1.00 | -2.21 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Lung, Muscle_Skeletal, Spleen, Whole_Blood