rs12693182 chr2:179264639 A>G
- Sequence
ggagcgggcccgggcggcggcggc[A/G]gcagcggcgacggctgcggctcca
- ASB in cell types
- iPS-derived dermal fibroblasts GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| iPS-derived dermal fibroblasts | 1.95 | 0.50 | 1.00 | |||
| GBM39 (Human brain tumor) | 1.72 | -0.86 | 1.00 |
Items per page:
1 – 2 of 2