rs12696600 chr3:190322418 C>A
- Sequence
ctggagtctggatactagaagctg[C/A]ggttgctcccaggctcgggaactg
- ASB in cell types
- glioblastoma patient-derived cell model D54 (H54, Human glioblastoma)
- ASB for transcription factors
- SMAD3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMAD3_HUMAN | 2.07 | -2.26 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1