rs12697060 chr5:68268104 A>C
- Sequence
atgtttatatatatatattattta[A/C]tccttattactgcacataattact
- ASB in cell types
- D341 Med (medulloblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| D341 Med (medulloblastoma) | 1.10 | -0.38 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, parkinsons disease, systolic blood pressure (sbp), years of education