rs12699256 chr7:11726536 C>G
- Sequence
ctgaggtctgcatgcagacagatg[C/G]ccagaattgattttttttgcaccc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) BIN-67 (Ovarian small cell carcinoma, hypercalcemic type)
- ASB for transcription factors
- SMRC1_HUMAN MTA2_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | n/a | 2.92 | 4.00 | n/a | n/a | |||
| MTA2_HUMAN | -1.30 | 1.30 | 1.00 | n/a | n/a | |||
| REQU_HUMAN | -0.98 | 2.10 | 2.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, childhood acute lymphoblastic leukemia, hdl cholesterol, obesity with early age of onset (age >2), total cholesterol