rs12699476 chr7:1928609 A>C
- Sequence
tcagacgccagcccttcttctcca[A/C]ctcccactaactgccgaacagggc
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.29 | 2.51 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), irritible bowel syndrome, microalbuminuria, rheumatoid arthritis, schizophrenia, spine bone mineral density (bmd), systolic blood pressure (sbp), tetrology of fallot, variant creutzfeldt-jakob disease