rs12700667 chr7:25862019 G>A
- Sequence
agagtgaaaatgtgacaaaagtga[G/A]cccctcggaccacacatgcaacca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.17 | 0.39 | 1.24 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, endometriosis, endometriosis (stage iii or iv disease), height, ldl cholesterol, schizophrenia, triglycerides, waist hip ratio
PheWAS abnormal findings on mammogram or breast exam, abnormality of red blood cells, acute laryngitis and tracheitis, acute pharyngitis, acute renal failure, acute upper respiratory infections, alzheimers disease, anal and rectal conditions, anemia in neoplastic disease, anorexia, aplastic anemia, arthropathy associated with neurological disorders, atrophic gastritis, bacterial infection nos, cancer of the digestive organs and peritoneum, cellulitis and abscess of arm, chronic lymphoid leukemia, chronic venous hypertension, dementias, disease of capillaries, disorders of external ear, disorders of function of stomach, disorders of menstruation, disorders of parathyroid gland, dyspepsia and disorders of function of stomach, femoral hernia, fever of unknown origin, genital prolapse, heart valve replaced, hemoptysis, hereditary hemolytic anemias, hyperparathyroidism, irregular menstrual cycle, irregular menstrual cycle/bleeding, joint effusions, magnesium metabolism disorder, non-healing surgical wound, nonrheumatic tricuspid valve disorders, other acute and subacute forms of ischemic heart disease, other conditions of brain, other dermatoses, other hemoglobinopathies, other hypertensive complications, other infectious diseases, other specified cardiac dysrhythmias, other specified disorders of plasma protein metabolism, pancytopenia, personality disorders, phobia, pilonidal cyst, premenstrual tension syndromes, pulmonary congestion and hypostasis, respiratory failure, right bundle branch block, shock, spondylosis with myelopathy, stiffness of joint, symptomatic artificial menopause, symptoms and disorders of the joints, symptoms involving female genital tract, testicular dysfunction, testicular hypofunction, type 2 diabetic peripheral circulatory disorders, ulcerative stomatitis & mucositis, urinary complications, vaginitis and vulvovaginitis, varicose veins of lower extremity