rs12700720 chr7:26278776 G>T
- Sequence
ccacgaacctcacctctccaaaac[G/T]taggtgcttttgtacatggaaatg
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -0.97 | 1.26 | 1.00 |
Items per page:
1 – 1 of 1