rs12701534 chr7:4289238 A>G
- Sequence
aattcctctttaagtatttggtag[A/G]gttctccagtgagtccatctggaa
- ASB in cell types
- macrophages form periferal blood
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 1.95 | -1.68 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), irritible bowel syndrome, microalbuminuria, premature ovarian failure