rs12702519 chr7:6504616 C>T
- Sequence
gacagtgagggtggggccagcacc[C/T]gcgcccagatgggatctggctggc
- ASB in cell types
- primary B-CLL cells 22RV1 (prostate carcinoma) CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- BRD4_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | n/a | 3.20 | 3.00 | n/a | n/a | |||
| ANDR_HUMAN | n/a | 3.12 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hip bone mineral density (bmd), spine bone mineral density (bmd), variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood