rs12703010 chr7:1640529 C>T
- Sequence
tggagccactggcgttggaagcac[C/T]gtttcctgccgtgtctcggaaggg
- ASB in cell types
- HeLa (cervical adenocarcinoma) WA09 (embryonic stem cells) HeLa S3 (cervical adenocarcinoma) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | -1.51 | 2.56 | 1.00 | |||
| WA09 (embryonic stem cells) | 2.01 | 0.69 | 1.00 | |||
| HeLa S3 (cervical adenocarcinoma) | 2.33 | -0.82 | 2.00 | |||
| GM02630 (Fanconi anemi) | -1.71 | 2.11 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), arthritis including non-rheumatoid, cystatin c in serum, eye color, hip osteoarthritis, osteoarthritis, osteoarthritis (females), sporadic creutzfeldt-jakob disease, stabilized warfarin dose, tetrology of fallot, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Breast_Mammary_Tissue, Ovary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid