rs12703132 chr7:151398346 C>T
- Sequence
gcatgtgtaagttgtgtatgagtg[C/T]atatgtatgttgtgtatgtgtgca
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.10 | 0.35 | 1.05 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.20 | 0.00 | 2.09 |
Items per page:
1 – 2 of 2