rs12704277 chr7:86598346 T>C
- Sequence
gaggaagagtccaagatggcagac[T/C]agaagcagctaatatgcgttggct
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma) VCaP (prostate carcinoma) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2B (prostate carcinoma) | n/a | 2.51 | 1.50 | |||
| VCaP (prostate carcinoma) | 2.20 | -1.88 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.84 | -0.14 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd