rs12705013 chr7:98872501 G>A
- Sequence
aaaaaaaaaaaaaaagtgctagac[G/A]gatgtcaccccctagtggcatcaa
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) IPSC-derived bipolar neuron RH4 (alveolar rhabdomyosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.51 | -1.17 | 1.00 | |||
| IPSC-derived bipolar neuron | 1.48 | -1.02 | 1.00 | |||
| RH4 (alveolar rhabdomyosarcoma) | 1.92 | 1.29 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Muscularis, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid