rs12705284 chr7:104857231 C>T
- Sequence
ctggaacgaaggctttttattcac[C/T]gctaccacggcagttttcctttcc
- ASB in cell types
- HT1080 (fibrosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HT1080 (fibrosarcoma) | 0.09 | 2.65 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, diastolic blood pressure (dbp), major depressive disorder