rs12705390 chr7:106770331 G>A
- Sequence
aatgagatctgtatgtaaactgat[G/A]agcctcatgcagacgccaaacaaa
- ASB in cell types
- SK-N-SH (neuroblastoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | -0.22 | 2.32 | 2.00 | 6.27 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), alzheimers disease, chronic kidney disease, coronary artery disease (cad), lp-pla2 mass, obesity with early age of onset (age >2), systolic blood pressure (sbp), triglycerides
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Testis