rs12706142 chr7:117134992 A>T
- Sequence
tcagcctccttttcctagctggct[A/T]ttgcagtttgtggacagtaaaagt
- ASB in cell types
- CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD14+ monocytes | 1.58 | -0.07 | 2.00 |
Items per page:
1 – 1 of 1