rs12706456 chr7:122893963 T>C
- Sequence
aaggataaagtaggtattttacta[T/C]gttgagcaaataaagctagtggat
- ASB in cell types
- MCF7 WS8 cells
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.58 | 1.73 | 2.02 | 0.66 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP college completion, diabetic retinopathy in type 2 diabetes mellitus, irritible bowel syndrome, maternal transmission distortion, prostate cancer