rs12706491 chr7:123131357 C>T
- Sequence
atcatagtaaagaaggagatgagt[C/T]tccttagaaacaattttccaccca
- ASB in cell types
- LNCaP (prostate carcinoma) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -4.00 | 3.40 | 3.50 | |||
| HeLa S3 (cervical adenocarcinoma) | n/a | 3.49 | 1.75 |
Items per page:
1 – 2 of 2