rs12706850 chr7:128425894 T>C
- Sequence
ctgtaaacagtcacataaactttt[T/C]caaagcaaattggcttggatggct
- ASB in cell types
- K562 (myelogenous leukemia) epidermal keratinocytes MCF7L-P(immortalized breast epithelial cell line) spleen
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.04 | 0.50 | 1.49 | |||
| epidermal keratinocytes | 2.48 | -1.70 | 2.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | -0.53 | 1.69 | 2.00 | |||
| spleen | 0.92 | -0.25 | 1.00 | |||
| BEAS-2B (bronchial epithelium) | -2.02 | 2.17 | 1.00 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood