rs12706898 chr7:129615156 G>T
- Sequence
ggaactatgaactgtcagtcttta[G/T]aaacagtctacagtcctacctcaa
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLM14 (Adult acute myeloid leukemia) | -1.11 | 1.47 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Hippocampus, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid