rs12707031 chr7:132225329 C>A
- Sequence
ggctgtcctgcagggtaggcagag[C/A]cgatattcagagctagcagccagc
- ASB in cell types
- breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.01 | 0.49 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, college completion, hdl cholesterol change with statins, serum creatinine