rs12707613 chr7:84109014 A>C
- Sequence
tgcaatatcatgactcatgtaaaa[A/C]gtgcaatatcatgcggagggagtt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- EMSY_HUMAN MAFG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EMSY_HUMAN | 2.30 | -2.09 | 1.00 | n/a | n/a | |||
| MAFG_HUMAN | 1.91 | -1.91 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Pituitary, Thyroid