rs12708003 chr8:60238591 T>G
- Sequence
agacctgggacccccgtgccttta[T/G]ctccagagctcatctagacctctc
- ASB in cell types
- Jurkat (T-cells)
- ASB for transcription factors
- KDM6A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM6A_HUMAN | 2.04 | -1.84 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cognitive response of healthy volunteers to topiramate treatment as measure by the digit span forward cognitive test, fasting blood glucose, triglycerides
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Brain_Anterior_cingulate_cortex_BA24, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Whole_Blood