rs12708492 chr15:67175203 T>C
- Sequence
gttgttccctgctttaaagtgaga[T/C]gattagggcggagccatgactgag
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ZBT17_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZBT17_HUMAN | -1.60 | 1.97 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adult asthma, asthma, childhood and later onset, asthma, childhood onset, asthma, childhood, later and unknown onset, and severe and industrial asthma, asthma, childhood, later and unknown onset, and severe asthma, coronary artery disease (cad), hypertension (early onset hypertension), ldl cholesterol, parkinsons disease, pediatric asthma, severe asthma, total cholesterol, transmission distortion