rs12709896 chr19:46402409 T>C
- Sequence
cgccagggggcgcaacgtggctca[T/C]tgtctccaaaaaacagccgctgtc
- ASB in cell types
- epidermal keratinocytes CD34+ hematopoietic stem cells H1-derived trophectodermal cells kidney
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 2.17 | -0.54 | 2.00 | |||
| CD34+ hematopoietic stem cells | 2.37 | -4.60 | 2.00 | |||
| H1-derived trophectodermal cells | 2.42 | -2.26 | 1.00 | |||
| kidney | -1.66 | 2.61 | 2.00 | |||
| Kelly (neuroblastoma) | 0.78 | 1.08 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood