rs12710562 chr22:37633716 A>G
- Sequence
caccccccgggccctgcaccggaa[A/G]aggccctgcaaaggggcctgtggc
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia) CTV-1 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line) Ishikawa (endometrial adenocarcinoma)
- ASB for transcription factors
- TCF21_HUMAN STAT1_HUMAN CDK8_HUMAN FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 2.06 | -3.18 | 1.50 | n/a | No Hit | |||
| STAT1_HUMAN | 0.25 | 1.88 | 1.57 | n/a | No Hit | |||
| CDK8_HUMAN | -0.28 | 2.33 | 1.00 | n/a | n/a | |||
| FLI1_HUMAN | -0.01 | 2.45 | 1.00 | 0.73 | Weak Concordant | |||
| RB_HUMAN | n/a | 3.07 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 7
Motif analysis
Genetic associations
GRASP birth weight, total cholesterol, total cholesterol change with statins, triglycerides change with statins, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood