rs12711473 chr16:87190687 A>G
- Sequence
tattggttgaaatattgctggagt[A/G]ttactggcatttacagaaggaggt
- ASB in cell types
- bipolar neuron GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 3.68 | -3.47 | 1.00 | |||
| GM23338 | 1.75 | -0.79 | 1.00 |
Items per page:
1 – 2 of 2