rs12711520 chr1:6260255 G>C
- Sequence
gtctccgcccgcgctgcagccgat[G/C]tgttccacggggcccggcctggcc
- ASB in cell types
- JB6 (Human anaplastic large cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| JB6 (Human anaplastic large cell lymphoma) | 2.34 | n/a | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Nerve_Tibial, Spleen, Testis