rs12711752 chr2:113080263 T>C
- Sequence
gctaaagatggcgacagagatcaa[T/C]gttggcgctgcctttttggggcta
- ASB in cell types
- Jurkat (T-cells) epidermal keratinocytes CD34+ stem cells-derived erythroblasts FT282 (normal human fallopian tube tissue)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Jurkat (T-cells) | -0.76 | 2.46 | 1.00 | |||
| epidermal keratinocytes | 2.20 | -0.54 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.48 | -0.75 | 2.00 | |||
| FT282 (normal human fallopian tube tissue) | 1.32 | 2.81 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Hippocampus, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood